raw.fasta 445 Bytes
Newer Older
peguerin's avatar
peguerin committed
1
2
3
4
5
6
7
8
9
10
11
12
>YCA_R0001; species_name=Haemulon flavolineatum
CCCCAAGCTCAACTAGCAACATGCCTAAAACACAAAAAATGCAAAGGGGAGGCAAGTCGT
AA
>YCA_R0002; species_name=Chaetodon ocellatus
CTCCAAGCCTAAAACTTTTTACTTTACTAATGTGCTGCAATTGTAGAGGAGAGGCAAGTC
GTAA
>REF-17-0642; species_name=Albula forsteri
CCTCGAATTACATGAGTAACAAGTATATAAGCTTTAAGGTAGCTATAAGAGGAGGTAAGT
CGTAA
>YCA_R0449; species_name=Stegastes xanthurus
CCCCTAAATTTGACATTTAACAATATTTAAAACCTTGCACAAGAAAGAGGGGAGAAAAGT
CGTAA