Commit 542faaeb authored by peguerin's avatar peguerin
Browse files

fasta raw test data

parent e8d3edc6
>YCA_R0001; species_name=Haemulon flavolineatum
CCCCAAGCTCAACTAGCAACATGCCTAAAACACAAAAAATGCAAAGGGGAGGCAAGTCGT
AA
>YCA_R0002; species_name=Chaetodon ocellatus
CTCCAAGCCTAAAACTTTTTACTTTACTAATGTGCTGCAATTGTAGAGGAGAGGCAAGTC
GTAA
>REF-17-0642; species_name=Albula forsteri
CCTCGAATTACATGAGTAACAAGTATATAAGCTTTAAGGTAGCTATAAGAGGAGGTAAGT
CGTAA
>YCA_R0449; species_name=Stegastes xanthurus
CCCCTAAATTTGACATTTAACAATATTTAAAACCTTGCACAAGAAAGAGGGGAGAAAAGT
CGTAA
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment