Commit 1de99045 authored by Bastien Macé's avatar Bastien Macé
Browse files

update README.md

parent 357d1b4a
......@@ -355,7 +355,7 @@ GTATTAAAACCATTTTAATGATTTAAACCAATCAAGTCCGAAATCCATTGAAACCCCAGAAAACAGGACAGATAAAAAAG
into a .txt file of this form:
sequence abundance
>sequence abundance
>GTATTAAAACCATTTTAATGATTTAAACCAATCAAGTCCGAAATCCATTGAAACCCCAGAAAACAGGACAGATAAAAAAGAAGACTCAAATAAGTACGAAATAGAGAGAGGTACAGAAATAGAACTGATGACCGCTAGCGATTTATTAATCAGATTAAACGTGTCCGCCCGCATGCAACCAGGCATCCCCATCCCTAGTCCCTAAACAGAAACACGCAGTAAGAACCTACCATC 7180
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment