Commit 826e1f5a authored by peguerin's avatar peguerin
Browse files

singularity path

parent a9d0509f
......@@ -18,3 +18,19 @@ ecoPCR_L=150
primer5=ACACCGCCCGTCACTCT
### 3' primer sequence
primer3=CTTCCGGTACACTTACCATG
OBITOOLS_SIMG="/media/superdisk/utils/conteneurs/obitools.simg"
## singularity exec command
SINGULARITY_EXEC_CMD="singularity exec --bind /media/superdisk:/media/superdisk"
###############################################################################
## softwares
#### obitools
ecotag=${SINGULARITY_EXEC_CMD}" "${OBITOOLS_SIMG}" ecotag"
obiannotate=${SINGULARITY_EXEC_CMD}" "${OBITOOLS_SIMG}" obiannotate"
obiuniq=${SINGULARITY_EXEC_CMD}" "${OBITOOLS_SIMG}" obiuniq"
obigrep=${SINGULARITY_EXEC_CMD}" "${OBITOOLS_SIMG}" obigrep"
ecoPCR=${SINGULARITY_EXEC_CMD}" "${OBITOOLS_SIMG}" ecoPCR"
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment