Update README-md

BaitDesigner_script.sh

+for i in `ls *masked.fasta`
+    do
+    sample=`echo $i | sed -e 's/_masked.fasta//g'`
+    java -jar /home/ines/envpicard/share/picard-2.22.1-0/picard.jar BaitDesigner R="$i" T="$sample"_masked.list DESIGN_NAME="$sample"_probes BAIT_SIZE=180 RIGHT_PRIMER=CCCTATAGTGAGTCGTATTA LEFT_PRIMER=null  BAIT_OFFSET=180
+    done
+
+for i in `ls *masked.fasta`
+    do
+    sample=`echo $i | sed -e 's/_masked.fasta//g'`
+    cat "$sample"_probes/"$sample"_probes.design.fasta >> rana_temporaria_mitochondrion_probes_T7.fasta
+    done
+
+sed '/^[^>]/s/[R|Y|W|S|M|K|H|B|V|D|N]//g' rana_temporaria_mitochondrion_probes_T7.fasta > rana_temporaria_mitochondrion_probes_T7_stringent.fasta
\ No newline at end of file

README.md

@@ -34,7 +34,7 @@ We can extract mitochondrion genome sequence from nuclear genome sequence.
 # Designing mitochondrial baits 
 
 We considered the two high-quality mitochondrial genomes assemblies available in NCBI, MH536744 and MT483700. Despite being less properly assebmled, a third  non-annotated mitocondrion sequence (LR991693) was included here since it aligned correctly except for two regions of 3500 and 1500  bp. 
-We targeted the complete mitochondrion genome, including less conservative regions in both intragenic and coding genes. To that end, we run [MAFFT] to align the three above-mentioned mitochondial genomes using Geneious. Positions containing any gaps were masked and removed.
+We targeted the complete mitochondrion genome, including less conservative regions in both intragenic and coding genes. To that end, we run MAFFT to align the three above-mentioned mitochondial genomes using Geneious. Positions containing any gaps were masked and removed.
 Baits were designed as **180 base pairs length**, spread across the entire mitochondrial genome (no overlapping sequences as no need for a mitochondrial assembly) using [BaitDesigner](https://gatk.broadinstitute.org/hc/en-us/articles/360037069172-BaitDesigner-Picard-). The T7 promoter was added to the 5' end of the baits for later transcription using the [NEB kit E2040S](https://international.neb.com/products/e2040-hiscribe-t7-high-yield-rna-synthesis-kit#Product%20Information). Altogether, there was only one ambiguity character which was simply depreciated.
 
 ![Transcription of DNA baits to RNA](./Transcription.png)