Commit 6f672227 authored by Carrasquer's avatar Carrasquer
Browse files

Update README-md

parent 7c3446da
for i in `ls *masked.fasta`
    do
    sample=`echo $i | sed -e 's/_masked.fasta//g'`
    java -jar /home/ines/envpicard/share/picard-2.22.1-0/picard.jar BaitDesigner R="$i" T="$sample"_masked.list DESIGN_NAME="$sample"_probes BAIT_SIZE=180 RIGHT_PRIMER=CCCTATAGTGAGTCGTATTA LEFT_PRIMER=null  BAIT_OFFSET=180
    done
for i in `ls *masked.fasta`
    do
    sample=`echo $i | sed -e 's/_masked.fasta//g'`
    cat "$sample"_probes/"$sample"_probes.design.fasta >> rana_temporaria_mitochondrion_probes_T7.fasta
    done
sed '/^[^>]/s/[R|Y|W|S|M|K|H|B|V|D|N]//g' rana_temporaria_mitochondrion_probes_T7.fasta > rana_temporaria_mitochondrion_probes_T7_stringent.fasta
\ No newline at end of file
......@@ -34,7 +34,7 @@ We can extract mitochondrion genome sequence from nuclear genome sequence.
# Designing mitochondrial baits
We considered the two high-quality mitochondrial genomes assemblies available in NCBI, MH536744 and MT483700. Despite being less properly assebmled, a third non-annotated mitocondrion sequence (LR991693) was included here since it aligned correctly except for two regions of 3500 and 1500 bp.
We targeted the complete mitochondrion genome, including less conservative regions in both intragenic and coding genes. To that end, we run [MAFFT] to align the three above-mentioned mitochondial genomes using Geneious. Positions containing any gaps were masked and removed.
We targeted the complete mitochondrion genome, including less conservative regions in both intragenic and coding genes. To that end, we run MAFFT to align the three above-mentioned mitochondial genomes using Geneious. Positions containing any gaps were masked and removed.
Baits were designed as **180 base pairs length**, spread across the entire mitochondrial genome (no overlapping sequences as no need for a mitochondrial assembly) using [BaitDesigner](https://gatk.broadinstitute.org/hc/en-us/articles/360037069172-BaitDesigner-Picard-). The T7 promoter was added to the 5' end of the baits for later transcription using the [NEB kit E2040S](https://international.neb.com/products/e2040-hiscribe-t7-high-yield-rna-synthesis-kit#Product%20Information). Altogether, there was only one ambiguity character which was simply depreciated.
![Transcription of DNA baits to RNA](./Transcription.png)
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment