Commit 22388173 authored by peguerin's avatar peguerin
Browse files

add mullus_dloop.fasta

parent 46e5b62a
>JX440237.1 Mullus surmuletus isolate FR18 D-loop, partial sequence; mitochondrial
TAGTAATCGTTACCCACCATGCCGAGCGTTCACTCCAGCGGGCAGGGGGTTCCTTTTTTCTTTTTCTTTT
CATCTGGCATCTCACAGTGCATTGAGGAGCGCAATAATAAGAGAGAACATCTTTCCCTGTATGCGTATAC
AAATGAAAAGTATTAAAGACATTAAAGAAGAAACACATAAACAGAATTCAAGGACATAATGCTGATCTAT
ACCTCCTCACATACCTGTTACCACCCCCTCTTCGTTTTTGCGTTTAACCCCCCTACCCCCCTACACTCGT
GAGATCCTTATCACTCCTGTAAACCCCCCGGAAACAGGAAAACCTCTGCGTGTGTTATAGCCCAAAATGT
GTTT
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment