Commit 92a8ed7e authored by peguerin's avatar peguerin
Browse files

adapters trimming

parent 46aa3884
......@@ -19,14 +19,18 @@ rule process_radtags:
enzyme=config["process_radtags"]["enzyme"],
trim_length=config["process_radtags"]["trim_length"],
score_limit=config["process_radtags"]["score_limit"],
windows_size=config["process_radtags"]["sliding_windows_size"],
adapter_mm=config["process_radtags"]["adapter_mm"],
encoded=config["process_radtags"]["encoded"],
barcode_dist_1=config["process_radtags"]["barcode_dist_1"]
adapter_1=config["process_radtags"]["adapter_1"],
adapter_2=config["process_radtags"]["adapter_2"],
barcode_dist_1=config["process_radtags"]["barcode_dist_1"],
barcode_dist_2=config["process_radtags"]["barcode_dist_2"]
log:
'10-logs/process_radtags/{runpool}.log'
shell:
'''mkdir -p {output};
process_radtags -i gzfastq -P -p {input} -o {output} -b 01-info_files/barcodes.txt -c -r -t {params.trim_length} --barcode_dist_1 {params.barcode_dist_1} --barcode_dist_2 {params.barcode_dist_2} -s {params.score_limit} -E {params.encoded} -e {params.enzyme} 2> {log}'''
process_radtags -i gzfastq -P -p {input} -o {output} -b 01-info_files/barcodes.txt -c -r -t {params.trim_length} --adapter_mm {params.adapter_mm} --adapter_1 {params.adapter_1} --adapter_2 {params.adapter_2} --barcode_dist_1 {params.barcode_dist_1} --barcode_dist_2 {params.barcode_dist_2} -w {params.windows_size} -s {params.score_limit} -E {params.encoded} -e {params.enzyme} 2> {log}'''
### clone filter
rule clone_filter:
......
process_radtags:
enzyme : SbfI
trim_length : 143
trim_length : 142
score_limit : 20
sliding_windows_size : 0.20
encoded : phred33
barcode_dist_1 : 2
barcode_dist_2 : 2
barcode_dist_1 : 1
barcode_dist_2 : 1
adapter_mm : 2
adapter_1 : ACACTCTTTCCCTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCAGAACAA,CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCC
adapter_2 : ACACTCTTTCCCTACACGACGCTCTTCCGATCT,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCAGAACAA,CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCC
species:
- mullus
- serran
......
......@@ -11,7 +11,6 @@ if [[ -z $check_already_indexed ]]; then
snakemake -s 00-scripts/step2.sf -j $CORES
fi
## assign (run, pool, barcode) to individual according to _infos.csv file and align them onto the genome
snakemake -s 00-scripts/step3.sf -j $CORES
snakemake -s 00-scripts/step3.sf -j $CORES -F
## run STACKS2 programs : gstacks & populations
snakemake -s 00-scripts/step4.sf -j $CORES
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment