... | ... | @@ -22,12 +22,18 @@ or |
|
|
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
|
|
|
```
|
|
|
|
|
|
#### Description line:
|
|
|
|
|
|
* The first character must be `>`
|
|
|
* The `ID` is the unique identifier of the sequence.
|
|
|
* `;` is the delimiter between identifier and species name
|
|
|
* `species_name=` is mandatory and must be the prefix of the species name
|
|
|
* `Mullus surmuletus` is the species name in NCBI taxonom. It have to be exactly the same than the name in NCBI taxonomy otherwise MKBDR will result a taxonomy fault. The name of the species is composed of 2 words _Genus_ and _species_ separated by a delimiter. The delimiter can be `_` or ` `. Otherwise MKBDR will result a format fault.
|
|
|
|
|
|
#### Sequence line:
|
|
|
|
|
|
* Only `A`, `T`, `G`, `C` characters are allowed. IUAPC ambiguities will result a fatal error.
|
|
|
* Gaps `-` are not allowed
|
|
|
* Empty sequences are not allowed
|
|
|
|
|
|
|